To Be or Not 2-b… That is the DNA!

dnaBeing was and necessary to seed potential into the Universe, which evolved and aged with the fundamental physical constants necessary to accommodate conscious life… “Let there be the Human Genome: Chromosome 1…”

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA

TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA

TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT

GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG

CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG

GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA

CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC

ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC

ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG

TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA

TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA

CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA

CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA

CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCACCACCATCA

CCAAGACCATCATCATCACCATCACCACCAACATCACCACCATCACCAACACCACCATCA

CCACCACCACCACCATCATCACCACCACCACCATCATCATCACCACCACCGCCATCATCA

TCGCCACCACCATGACCACCACCATCACAACCATCACCACCATCACAACCACCATCATCA

CTATCGCTATCACCACCATCACCATTACCACCACCATTACTACAACCATGACCATCACCA

CCATCACCACCACCATCACAACGATCACCATCACAGCCACCATCATCACCACCACCACCA

CCACCATCACCATCAAACCATCGGCATTATTATTTTTTTAGAATTTTGTTGGGATTCAGT

ATCTGCCAAGATACCCATTCTTAAAACATGAAAAAGCAGCTGACCCTCCTGTGGCCCCCT

TTTTGGGCAGTCATTGCAGGACCTCATCCCCAAGCAGCAGCTCTGGTGGCATACAGGCAA

CCCACCACCAAGGTAGAGGGTAATTGAGCAGAAAAGCCACTTCCTCCAGCAGTTCCCTGT

CTGAGCTGCTGTCCTTGGACTTGAAGAAGCTTCTGGAACATGCTGGGGAGGAAGGAAGAC

ATTTCACTTATTGAGTGGCCTGATGCAGAACAGAGACCCAGCTGGTTCACTCTAGTTCGG

ACTAAAACTCACCCCTGTCTATAAGCATCAGCCTCGGCAGGATGCATTTCACATTTGTGA

TCTCATTTAACCTCCACAAAGACCCAGAAGGGTTGGTAACATTATCATACCTAGGCCTAC

TATTTTAAAAATCTAACACCCATGCAGCCCGGGCACTGAAGTGGAGGCTGGCCACGGAGA

GAGCCAGGCAATCACTGGCTTTTCCTTAGACAGAGAGCTGGTTCCTAGGAGAAGAAGCTC

CAGGCTGGGGTCCAGGCTATGACCCAACTGTTCAGTTTTGCAACATCCAGCATGGCTGCC

TGATCAGGGGTGCATATGTCAGAGGAGCCTTCAGCTGGGAAGTGCTGACAAATGACCCAG

ACCTGACCTGCCCGATGCCAAGGCCTCCTTTAGTACATCCCATGGAGGACACTTGAGACA

And so it continued for 1000 lines… and the arguments began about whether there was more being said here regarding the human condition, than there is in the entire works of William Shakespeare.

2b20c191f7c7badd5fb018263fa01ad7Enter the Great Father of DNA with his impassioned call to action… Thus Spake Physicist and Molecular Biologist Francis Crick (1916-2004) yelling from the mountaintop with great joy: “You, your joys and your sorrows, your memories and your ambitions, your sense of personal identity and free will, are in fact no more than the behaviour of a vast assembly of nerve cells and their associated molecules.”

7f8e9a05773c28099ae90515ae47dfa4Such kind words did not go unnoticed by the much admired Scientist Carl Sagan (1934-1996) who couldn’t help adding this inspiring message in celebration of the human spirit: Our planet is a lonely speck in the great enveloping cosmic dark. In our obscurity – in all this vastness – there is no hint the help will come from elsewhere to save us from ourselves…

So with that may you –

all your sorrows –

all your joys –

on this vast lonely speck,

 in the great enveloping cosmic dark,

 have peaceful dreams.

Advertisements

4 thoughts on “To Be or Not 2-b… That is the DNA!”

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s